Create / log into an m1.medium Jetstream instance, and run these two commands:
cd ~/
curl -O https://s3-us-west-1.amazonaws.com/spacegraphcats.ucdavis.edu/microbe-genbank-sbt-k31-2017.05.09.tar.gz
tar xzf microbe-genbank-sbt-k31-2017.05.09.tar.gz
– they take a long time :).
K-mers are a fairly simple concept that turn out to be tremendously powerful.
A “k-mer” is a word of DNA that is k long:
ATTG - a 4-mer
ATGGAC - a 6-mer
Typically we extract k-mers from genomic assemblies or read data sets by running a k-length window across all of the reads and sequences – e.g. given a sequence of length 16, you could extract 11 k-mers of length six from it like so:
AGGATGAGACAGATAG
becomes the following set of 6-mers:
AGGATG
GGATGA
GATGAG
ATGAGA
TGAGAC
GAGACA
AGACAG
GACAGA
ACAGAT
CAGATA
AGATAG
k-mers are most useful when they’re long, because then they’re specific. That is, if you have a 31-mer taken from a human genome, it’s pretty unlikely that another genome has that exact 31-mer in it. (You can calculate the probability if you assume genomes are random: there are 431 possible 31-mers, and 431 = 4,611,686,018,427,387,904. So, you know, a lot.)
The important concept here is that long k-mers are species specific. We’ll go into a bit more detail later.
We’ve already run into k-mers before, as it turns out - when we were doing genome assembly. One of the three major ways that genome assembly works is by taking reads, breaking them into k-mers, and then “walking” from one k-mer to the next to bridge between reads. To see how this works, let’s take the 16-base sequence above, and add another overlapping sequence:
AGGATGAGACAGATAG
TGAGACAGATAGGATTGC
One way to assemble these together is to break them down into k-mers –
becomes the following set of 6-mers:
AGGATG
GGATGA
GATGAG
ATGAGA
TGAGAC
GAGACA
AGACAG
GACAGA
ACAGAT
CAGATA
AGATAG -> off the end of the first sequence
GATAGG <- beginning of the second sequence
ATAGGA
TAGGAT
AGGATT
GGATTG
GATTGC
and if you walk from one 6-mer to the next based on 5-mer overlap, you get the assembled sequence:
AGGATGAGACAGATAGGATTGC
Graphs of many k-mers together are called De Bruijn graphs, and assemblers like MEGAHIT and SOAPdenovo are De Bruijn graph assemblers - they use k-mers underneath.
Computers love k-mers because there’s no ambiguity in matching them. You either have an exact match, or you don’t. And computers love that sort of thing!
Basically, it’s really easy for a computer to tell if two reads share a k-mer, and it’s pretty easy for a computer to store all the k-mers that it sees in a pile of reads or in a genome.
So, we’ve said long k-mers (say, k=31 or longer) are pretty species specific. Is that really true?
Yes! Check out this figure from the MetaPalette paper:

here, the Koslicki and Falush show that k-mer similarity works to group microbes by genus, at k=40. If you go longer (say k=50) then you get only very little similarity between different species.
So, one thing you can do is use k-mers to compare genomes to genomes, or read data sets to read data sets: data sets that have a lot of similarity probably are similar or even the same genome.
One metric you can use for this comparisons is the Jaccard distance, which is calculated by asking how many k-mers are shared between two samples vs how many k-mers in total are in the combined samples.
only k-mers in both samples
----------------------------
all k-mers in either or both samples
A Jaccard distance of 1 means the samples are identical; a Jaccard distance of 0 means the samples are completely different.
This is a great measure and it can be used to search databases and cluster unknown genomes and all sorts of other things! The only real problem with it is that there are a lot of k-mers in a genome – a 5 Mbp genome (like E. coli) has 5 m k-mers!
About a year ago, Ondov et al. (2016) showed that MinHash approaches could be used to estimate Jaccard distance using only a small fraction (1 in 10,000 or so) of all the k-mers.
The basic idea behind MinHash is that you pick a small subset of k-mers to look at, and you use those as a proxy for all the k-mers. The trick is that you pick the k-mers randomly but consistently: so if a chosen k-mer is present in two data sets of interest, it will be picked in both. This is done using a clever trick that we can try to explain to you in class - but either way, trust us, it works!
We have implemented a MinHash approach in our sourmash software, which can do some nice things with samples. We’ll show you some of these things next!
To install sourmash, run:
sudo apt-get -y update && \
sudo apt-get install -y python3.5-dev python3.5-venv make \
libc6-dev g++ zlib1g-dev
this installs Python 3.5.
Now, create a local software install and populate it with Jupyter and other dependencies:
python3.5 -m venv ~/py3
. ~/py3/bin/activate
pip install -U pip
pip install -U Cython
pip install -U jupyter jupyter_client ipython pandas matplotlib scipy scikit-learn khmer
pip install -U https://github.com/dib-lab/sourmash/archive/master.zip
Download some reads and a reference genome:
mkdir ~/data
cd ~/data
wget http://public.ged.msu.edu.s3.amazonaws.com/ecoli_ref-5m-trim.pe.fq.gz
wget https://s3.amazonaws.com/public.ged.msu.edu/ecoliMG1655.fa.gz
Compute a scaled MinHash signature from our reads:
mkdir ~/sourmash
cd ~/sourmash
sourmash compute --scaled 10000 ~/data/ecoli_ref*pe*.fq.gz -o ecoli-reads.sig -k 31
Use case: how much of the read content is contained in the reference genome?
Build a signature for an E. coli genome:
sourmash compute --scaled 10000 -k 31 ~/data/ecoliMG1655.fa.gz -o ecoli-genome.sig
and now evaluate containment, that is, what fraction of the read content is contained in the genome:
sourmash search -k 31 ecoli-reads.sig ecoli-genome.sig --containment
and you should see:
# running sourmash subcommand: search
loaded query: /home/ubuntu/data/ecoli_ref-5m... (k=31, DNA)
loaded 1 signatures from ecoli-genome.sig
1 matches:
similarity match
---------- -----
46.6% /home/ubuntu/data/ecoliMG1655.fa.gz
Why are only 50% or so of our k-mers from the reads in the genome!? Any ideas?
Try the reverse - why is it bigger?
sourmash search -k 31 ecoli-genome.sig ecoli-reads.sig --containment
(...but 99% of our k-mers from the genome are in the reads!?)
This is basically because of sequencing error! Illumina data contains a lot of errors, and the assembler doesn’t include them in the assembly!
Suppose that we have a collection of signatures (made with sourmash compute as above) and we want to search it with our newly assembled
genome (or the reads, even!). How would we do that?
Let’s grab a sample collection of 50 E. coli genomes and unpack it –
mkdir ecoli_many_sigs
cd ecoli_many_sigs
curl -O -L https://github.com/dib-lab/sourmash/raw/master/data/eschericia-sigs.tar.gz
tar xzf eschericia-sigs.tar.gz
rm eschericia-sigs.tar.gz
cd ../
This will produce 50 files named ecoli-N.sig in the ecoli_many_sigs –
ls ecoli_many_sigs
Let’s turn this into an easily-searchable database with sourmash index –
sourmash index -k 31 ecolidb ecoli_many_sigs/*.sig
What does the database look like and how does the search work?

One point to make with this is that the search can quickly narrow down which signatures match your query, without losing any matches. It’s a clever example of how computer scientists can actually make life better :).
And now we can search!
sourmash search ecoli-genome.sig ecolidb.sbt.json -n 20
You should see output like this:
# running sourmash subcommand: search
select query k=31 automatically.
loaded query: /home/tx160085/data/ecoliMG165... (k=31, DNA)
loaded SBT ecolidb.sbt.json
Searching SBT ecolidb.sbt.json
49 matches; showing first 20:
similarity match
---------- -----
75.4% NZ_JMGW01000001.1 Escherichia coli 1-176-05_S4_C2 e117605...
72.2% NZ_GG774190.1 Escherichia coli MS 196-1 Scfld2538, whole ...
71.4% NZ_JMGU01000001.1 Escherichia coli 2-011-08_S3_C2 e201108...
70.1% NZ_JHRU01000001.1 Escherichia coli strain 100854 100854_1...
69.0% NZ_JH659569.1 Escherichia coli M919 supercont2.1, whole g...
64.9% NZ_JNLZ01000001.1 Escherichia coli 3-105-05_S1_C1 e310505...
63.0% NZ_MOJK01000001.1 Escherichia coli strain 469 Cleandata-B...
62.9% NZ_MOGK01000001.1 Escherichia coli strain 676 BN4_676_1_(...
62.0% NZ_JHDG01000001.1 Escherichia coli 1-176-05_S3_C1 e117605...
59.9% NZ_MIWF01000001.1 Escherichia coli strain AF7759-1 contig...
52.7% NZ_KE700241.1 Escherichia coli HVH 147 (4-5893887) acYxy-...
51.7% NZ_APWY01000001.1 Escherichia coli 178200 gec178200.conti...
49.3% NZ_LVOV01000001.1 Escherichia coli strain swine72 swine72...
49.3% NZ_MIWP01000001.1 Escherichia coli strain K6412 contig_00...
49.0% NZ_LQWB01000001.1 Escherichia coli strain GN03624 GCID_EC...
48.9% NZ_JHGJ01000001.1 Escherichia coli O45:H2 str. 2009C-4780...
48.1% NZ_CP011331.1 Escherichia coli O104:H4 str. C227-11, comp...
47.7% NZ_JHNB01000001.1 Escherichia coli O103:H25 str. 2010C-45...
47.7% NZ_JHRE01000001.1 Escherichia coli strain 302014 302014_1...
47.6% NZ_JHHE01000001.1 Escherichia coli O103:H2 str. 2009C-327...
identifying what genome is in the signature.
Adjust plotting (this is a bug in sourmash :) –
echo 'backend : Agg' > matplotlibrc
Compare all the things:
sourmash compare ecoli_many_sigs/* -o ecoli_cmp
and then plot:
sourmash plot --pdf --labels ecoli_cmp
which will produce a file ecoli_cmp.matrix.pdf and ecoli_cmp.dendro.pdf
which you can then download via FileZilla and view on your local computer.
Here’s a PNG version:

At the beginning, we downloaded and unpacked a GenBank index of all the microbial genomes – you can see a basic description here, CTB’s blog post – this one contains sketches of all 100k Genbank microbes. (See available sourmash databases for more information.)
After this database is unpacked, it produces a file
genbank-k31.sbt.json and a whole bunch of hidden files in the
directory .sbt.genbank-k31.
Next, run the ‘gather’ command to see what’s in your ecoli genome –
sourmash gather -k 31 ecoli-genome.sig ../genbank-k31.sbt.json
and you should get:
# running sourmash subcommand: sbt_gather
loaded query: /home/ubuntu/data/ecoliMG1655.... (k=31, DNA)
overlap p_query p_match
--------- ------- --------
4.9 Mbp 100.0% 99.8% CP011320.1 Escherichia coli strain SQ37,
found 1 matches total;
the recovered matches hit 100.0% of the query
In this case, the output is kind of boring because this is a single genome. But! You can use this on metagenomes (assembled and unassembled) as well; you’ve just got to make the signature files.
To see this in action, here is gather running on a signature generated from some sequences that assemble (but don’t align to known genomes) from the Shakya et al. 2013 mock metagenome paper.
wget https://github.com/dib-lab/sourmash/raw/master/doc/_static/shakya-unaligned-contigs.sig
sourmash gather -k 31 shakya-unaligned-contigs.sig ../genbank-k31.sbt.json
This should yield:
# running sourmash subcommand: gather
loaded query: mqc500.QC.AMBIGUOUS.99.unalign... (k=31, DNA)
loaded SBT genbank-k31.sbt.json
overlap p_query p_match
--------- ------- --------
1.4 Mbp 11.0% 58.0% JANA01000001.1 Fusobacterium sp. OBRC1 c
1.0 Mbp 7.7% 25.9% CP001957.1 Haloferax volcanii DS2 plasmi
0.9 Mbp 7.5% 11.8% BA000019.2 Nostoc sp. PCC 7120 DNA, comp
0.7 Mbp 5.9% 23.0% FOVK01000036.1 Proteiniclasticum ruminis
0.7 Mbp 5.3% 17.6% AE017285.1 Desulfovibrio vulgaris subsp.
0.6 Mbp 4.9% 11.1% CP001252.1 Shewanella baltica OS223, com
0.6 Mbp 4.8% 27.3% AP008226.1 Thermus thermophilus HB8 geno
0.6 Mbp 4.4% 11.2% CP000031.2 Ruegeria pomeroyi DSS-3, comp
480.0 kbp 3.8% 7.6% CP000875.1 Herpetosiphon aurantiacus DSM
410.0 kbp 3.3% 10.5% CH959317.1 Sulfitobacter sp. NAS-14.1 sc
1.4 Mbp 10.9% 11.8% LN831027.1 Fusobacterium nucleatum subsp
0.5 Mbp 4.1% 5.3% CP000753.1 Shewanella baltica OS185, com
420.0 kbp 3.3% 7.7% FNDZ01000023.1 Proteiniclasticum ruminis
150.0 kbp 1.2% 4.5% CP015081.1 Deinococcus radiodurans R1 ch
150.0 kbp 1.2% 8.2% CP000969.1 Thermotoga sp. RQ2, complete
290.0 kbp 2.3% 4.1% CH959311.1 Sulfitobacter sp. EE-36 scf_1
1.2 Mbp 9.4% 5.0% CP013328.1 Fusobacterium nucleatum subsp
110.0 kbp 0.9% 3.5% FREL01000833.1 Enterococcus faecalis iso
0.6 Mbp 5.0% 2.8% CP000527.1 Desulfovibrio vulgaris DP4, c
340.0 kbp 2.7% 3.3% KQ235732.1 Fusobacterium nucleatum subsp
70.0 kbp 0.6% 1.2% CP000850.1 Salinispora arenicola CNS-205
60.0 kbp 0.5% 0.7% CP000270.1 Burkholderia xenovorans LB400
50.0 kbp 0.4% 2.6% CP001080.1 Sulfurihydrogenibium sp. YO3A
50.0 kbp 0.4% 3.2% L77117.1 Methanocaldococcus jannaschii D
found less than 40.0 kbp in common. => exiting
found 24 matches total;
the recovered matches hit 73.4% of the query
In our recent preprint using this, we showed that
It is straightforward to build your own databases for use with
search and gather; this is of interest if you have dozens or
hundreds of sequencing data sets in your group. Ping us if you want us
to write that up.
There are many tools like Kraken and Kaiju that can do taxonomic classification of individual reads from metagenomes; these seem to perform well (albeit with high false positive rates) in situations where you don’t necessarily have the genome sequences that are in the metagenome. Sourmash, by contrast, can estimate which known genomes are actually present, so that you can extract them and map/align to them. It seems to have a very low false positive rate and is quite sensitive to strains.
Above, we’ve shown you a few things that you can use sourmash for. Here is a (non-exclusive) list of other uses that we’ve been thinking about –
Chat with Luiz, Phil, or Titus if you are interested in these use cases!